Again, SARS-2 Is Man-made.
By Zhiyan-Le, 2020-03-02/ updated: 2020-04-25.
https://sites.google.com/site/zhiyanpage2/2020/z20200427-manmade
https://zhiyanleback.blogspot.com/p/again-sars-2-is-manmade.html

My previous essays said that the SARS-2 (new corona-virus caused this global pandemic, Covid-19) is manmade. I am saying so again with a brief but evidence-based discussion. That is, WIV1 ( KF367457.1 ), a SARS-like virus, has played a key role: It can directly jump to humans, i.e., fits into how this pandemic event happened and continues; and it contains manmade factors. Thus, it is most likely that a human-developed virus based on WIV1 is the real origin of this SARS-2 global epidemic event. (note: It is said that WIV1 refers to: Wuhan Institute of Virology, the 1st).


Material:

Corona virus/related genetic info/data in this essay come from NIH GenBank, such as:
 

Table 1: Samples (source: NIH, GenBank, 2020-04-24)
	Temp-Name	GenBank ID	Length	Collect Date	Source
1	SARS-2	MN996527.1	29825	y2019-12	WH-Inst, China
2	Bat-2012 (WIV1)	KF367457.1	30309	y2012-09	WH-Inst, China
3	RaTG13	MN996532.1	29855	y2013-07	WH-Inst, China
4	SARS-2003	AY304488.1	29731	y2003-05	HK-Univ, China
5	Bat-2005	DQ022305.2	29728	y2005-04	HK-Univ, China
6	HuB-2013	KJ473814.1	29658	y2013-xx	BJ-Inst, China
7	Bat-Yunnan	JX993988.1	29452	y2011-xx	BJ-Inst, China
8	SARS-2-USA	MT159718.1	29882	y2020-02	USA
9	Bat-2012 (WIV1-S-gene_cds)	KC881007.1	3771	y2012-09	WH-Inst, China
SARS-2 and SARS-2-USA: from Covid-19 patients; the rest: SARS or SARS-like.
WH-Inst: Wuhan Institute of Virology. HK-Univ: Hong Kong University.
BJ-Inst:  Chinese Academy of Medical Sciences & Peking Union Medical College

Among them, 7 come from Chinese researchers (Wuhan, Hong Kong and Beijing institutes) and 1 from American collectors. SARS-2 and SARS-2-USA were collected from local patients, one is earliest possible and the later is most recent by the date of this writing. Others are SARS/SARS-like viruses.

Bat-2012 (WIV1) is a key factor here, reason:

First, it is known due in large to ACE2 related paper by Dr. Shi Zhengli (Chinese) and Dr. Daszak (American) in Wuhan Institute of Virology, please see:

Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor.
Daszak P, Shi ZL., Nature. 2013 Nov 28;503 (7477):535-8.
https://www.nature.com/articles/nature12711 


Secondly, PNAS publication warned that WIV1 is poised and can directly transmit to human, please see:

SARS-like WIV1-CoV poised for human emergence.
Vineet D. Menachery, .... and Ralph S. Baric. PNAS March 15, 2016.
https://www.pnas.org/content/pnas/113/11/3048.full.pdf 
It said:
……. Both full-length and chimeric WIV1-CoV readily replicated efficiently in human airway cultures and in vivo, suggesting capability of direct transmission to humans. In addition, while monoclonal antibody treatments prove effective, the SARS-based vaccine approach failed to confer protection. Together, the study indicates an ongoing threat posed by WIV1-related viruses and the need for continued study and surveillance. …… Synthetic construction of chimeric mutant and full-length WIV1-CoV were approved by the UNC Institutional Biosafety Committee and the Dual Use Research of Concern Committee.

As we know, synthetic construction means artificial or manmade work, not a natural process and, because of it can directly transmit to humans, WIV1 had a serious potential causing pandemic. Please see below, a warning news report.


Thirdly, at the time when WIV1 was known, relevant media published warning news report, such as:

New SARS-like virus is poised to infect humans.
Date: March 14, 2016.
https://www.sciencedaily.com/releases/2016/03/160314211501.htm 
……Baric and Menachery worked with SARS-like coronavirus sequences isolated from Chinese horseshoe bats, where SARS originated. Based on the sequences, they reconstructed the viruses to evaluate their potential to infect human cells and in mice. They found that the newly identified virus, known as WIV1-CoV, could bind to the same receptors as SARS-CoV. They also showed that the virus readily and efficiently replicated in cultured human airway tissues, suggesting an ability to jump directly to humans. "To be clear, this virus may never jump to humans, but if it does, WIV1-CoV has the potential to seed a new outbreak with significant consequences for both public health and the global economy," said Vineet, whose work is reported in the Mar. 13, 2016 online version of the Proceedings of the National Academy of Sciences.

And the warnings re WIV1 are now becoming a huge reality locally and globally.


Method and Results

The method is provided by NIH-BLAST. The alignment results are:
 

Table 2: Alignments
Name		Identities
Query	Subject	S-Gene	Whole	S-Gene x Whole
Bat-RaTG13	SARS-2	98%	96%	10%
Bat-2012(WIV1)	SARS-2	63%	78%	11%
Bat-2012(WIV1)	Bat-RaTG13	63%	78%	11%
Bat-2012(WIV1)	Bat-Yunnan		89%
Bat-2012(WIV1)	HuB-2013		87%
Bat-2012(WIV1)	SARS-2003		94%	11%
Bat-RaTG13	HuB-2013		79%
Bat-2012(WIV1)	SARS-2-USA	87%	78%	11%
Bat-2012(WIV1)	Bat-2012 (WIV1-S-cds)	70%

Discussion

The bat-RaTG13 is said as the origin of SARS-2, for its very high identities. However, its virus does not directly transmit to human.

WIV1 (Bat-2012) has a lower identities with SARS-2, however, its affinity ratio is obviously higher than that of bat-RaTG13, shown by 11% and 10%, respectively, in the above table. More over, its virus can directly transmit to human. And please note that WIV1 has 94% identity (almost there at 96% of bat-RaTG13) with SARS-2003 that had caused the 2003 global pandemic.  Based on these terms to estimate, the SARS-2-S-gene with lower identity (78%-80%) has the affinity power 10 times greater than that of RaTG13 which has a much higher identity up to 96%.


To further study WIV1, aligning it with others provided by the above samples, then, there come uniformed gaps, such as:


>GAP-1，by Bat-RaTG13 x Bat-2012：
TCCTTGATAAACGAACCACTATGTTACTTTTAGTAACATTGTTTGGTTTAGCATCAGGGT
GCAGCTTACCACTTACGGTTAGCTGCCCTAGAGGCCTACCTTTCACTCTACAGATTAACA
CTACTAGTGTTACTGTGGAGTGGTATCGGGTATCTCCTGCATCAATGCAAGGTCTTACAA
AGATAAATACTGGCAGCACTATTTTTGATAACAACTTTAGTGTAGTCAATAATAATTTGT
ACTTCAAACAGTGTTTTGGAGGCTTTTTTTTACAGCACGCTGTTACCGCCAGGGTAAGCA
TGACGGTGCTATAGTAGATAATTCTCAACCTGTCTTTGTGGATGCTAGGAATTATGTACC
AACTACTGCACTATTAGTCTCATCGCAGGGCATTGTGCAGCCAAAAAGTTCCAATGTGTT
AGCTATAGTGTTACCTATAGCCCTTGTTGGTATTTGTCTTTTTATTCTTTTACTTTGGTA
TTTGTTTTCTAAGCAAAACAAAATTTACCAACAGGCCACGCAATCAGTCTAA

>Gaps, the Rest Alignments
CGAACCACTATGTTACTTTTAGTAACATTGTTTGGTTTAGCATCAGGGTGCAGCTTACCA
CTTACGGTTAGCTGCCCTAGAGGCCTACCTTTCACTCTACAGATTAACACTACTAGTGTT
ACTGTGGAGTGGTATCGGGTATCTCCTGCATCAATGCAAGGTCTTACAAAGATAAATACT
GGCAGCACTATTTTTGATAACAACTTTAGTGTAGTCAATAATAATTTGTACTTCAAACAG
TGTTTTGGAGGCTTTTTTTTACAGCACGCTGTTACCGCCAGGGTAAGCATGACGGTGCTA
TAGTAGATAATTCTCAACCTGTCTTTGTGGATGCTAGGAATTATGTACCAACTACTGCAC
TATTAGTCTCATCGCAGGGCATTGTGCAGCCAAAAAGTTCCAATGTGTTAGCTATAGTGT
TACCTATAGCCCTTGTTGGTATTTGTCTTTTTATTCTTTTACTTTGGTATTTGTTTTCTA
AGCAAAACAAAATTTACCAACAGGCCACGCAATCAGTCTAA

A natural process is random. Such a uniformed gap at the same location with the same length, or uniformed mutation, would be impossible within natural animals in a period of less than 20 years. However, manmade work, such as gene editing or other genetic modification, can make it happen in just a year or few months.

That means that natural animals such as bats do not have those uniformed gap genes. Then the question is: where does the gap gene come from?

By NIH BLAST covid-19 search, the result is:
 

Table 3: GAP Search
Organism	Per. Ident	Discroibtion	Source
KF367457.1	100.00%	Bat SARS-like WIV1	WH-Inst,2012-09
KT444582.1	99.62%	SARS-like WIV16	WH-Inst,2013-07
KY417150.1	99.25%	Bat SARS-like Rs4874	WH-Inst,2013-07
MK211378.1	98.87%	BtRs-BetaCoV/YN2018D	BJ-Inst,2016-09
MK211376.1	98.87%	BtRs-BetaCoV/YN2018B	BJ-Inst,2016-09
KY417151.1	98.68%	Bat SARS-like Rs7327	WH-Inst,2014-10

The result shows that the gap genes come from Wuhan or Beijing institutes, China. If the SARS-2 origin is natural animals such bats, why not do they come but just those SARS-like come from Wuhan and Beijing institutes?

Further, take WIV1-S-Gene (3768 bp) as root, the search result is (criteria: NIH, Data-base-genomic / Viruses / Betacoronavirus):
 

Table 4: WiV1 S-Gene Search (by NIH Blast)
Accession	Per. Ident	Discribtion	Year
GM741413.1	91.74%	Sequence 147 from Patent WO2008004992	2008
HC187344.1	91.74%	Sequence 1313 from Patent WO2009130588	2009
HC494680.1	91.74%	Sequence 1313 from Patent WO2009022236	2009
LQ338105.1	91.74%	Sequence 147 from Patent EP3001990	2016 [*]
CS244439.1	78.48%	Sequence 3 from Patent WO2005118813	2006
CS244442.1	78.48%	Sequence 6 from Patent WO2005118813	2006
[*]: Updated from 2005 version.

All are not bat or other animals, but patents filed before WIV1 was collected. As we know, natural things cannot be patented, i.e., patents re S-Gene recombination are manmade.


A Piece of Cake

In 2007, the Wuhan Institute of Virology had an S-Gene patent of SARS corona virus, see:

Recombination baculoviral for highly effectively expressing SARS coronavirus S protein and construction thereof.
CN101100680, 15.06.2007, by Wuhan Institute of Virology, CAS.
https://patentscope.wipo.int/search/zh/detail.jsf?docId=CN83294681 

It produced manmade S-gene. Let’s call it as Patent-2007 and align it with some of the above samples, result:
 

Table 5: Patent-2007 (3768 bp) as Query, Alignment:
Subject	Length	Date	Identities
S-Gene from WIV1	3768	y2012-09-18	68%
S-Gene from WIV16	3765	y2013-07-21	69%
S-Gene from RaTG13	3807	y2013-07-24	63%
S-Gene from SARS-2	3819	y2019-12-30	63%
WIV1 S-Gene (cds)	3771	y2012-09-18	90%

The identities are highly similar to each other. Since they are in different length and came years after the patent 2007, the similarity well raises a point that the new corona virus contains manmade factors such as gene editing.

And that includes bat RaTG13 genome, which was collected in 2013-07 but shared with international community in January 2020. Since CRSIPR/Cas has become popular in China and gene-edited babies were born there, anything can happen in the nation: It would be just a piece of cake that the new corona virus and its container like bat RaTG13 are genetically modified.

The identity of [patent-2007 x WIV1-S-Gene-cds] is 90%, obviously higher than others. And the identity of [WIV1-S-Gene_cds x S-Gene-WIV1-2012] is 70% (see above, Table-2), although both come from the same source, host, location and date, and the same paper.

How come? The providers (the Chinese and American researchers of The Wuhan Institute of Virology) did not explain, leaving some serious missing genetic information links among the patents, WIV1 and its S-Protein-Gene, SARS-2 and this global corona-virus pandemic.

Therefore, one should not be surprised that, on 2018-04-05, the PRC state-run media announced that Wuhan Institute found the new corona-virus and, on 2019-09-18, just two month before the SARS-2 outbreak started, a real-time exercise, which applied the new corona-virus and its pandemic as a sample case, was held in Wuhan City, China.

So far, some key genetic info/data of the announced / exercised new corona virus remains closed to the international community, while the virus is spreading all over the world and caused tens of thousands casualties.
.

Reference Images (top down)

Image 01: A Uniformed GAP, Search Result.
(identical organisms pointing at Wuhan and Beijing, China, dated from 2012 to 2016).



Figure 1: WIV1 S-Gene (3768) as root, align search result is (criteria: NIH, Data-base-genomic / Viruses / Betacoronavirus): All are patents which had been filed years before WIV1 was collected.




Figure 2: In March 2016, NAS publication warned WIV1, a corona virus, could directly transmit to human and cause serious pandemic around the world. The photo image, in which people were wearing masks in subway, is now becoming a daily must around the globe.




Figure 3: April 5, 2018, the CCTV (PRC state run media) announced that Wuhan Institute of virology found a SARS-like new corona virus and took it as an important achievement by the Chinese scientists.




Figure 4: September 18, 2019, in Wuhan City of China, a local government new media reported that a real-time exercise was held, which used the new corona virus and its epidemic/treatment as a sample case.