Again,
SARS-2 Is Man-made.
By Zhiyan-Le, 2020-03-02/
updated: 2020-04-25.
https://sites.google.com/site/zhiyanpage2/2020/z20200427-manmade
https://zhiyanleback.blogspot.com/p/again-sars-2-is-manmade.html
My previous essays said that the SARS-2 (new corona-virus caused this global
pandemic, Covid-19) is manmade. I am saying so again with a brief but
evidence-based discussion. That is, WIV1 (
KF367457.1
), a SARS-like virus, has played a key role: It can directly jump to humans,
i.e., fits into how this pandemic event happened and continues; and it contains
manmade factors. Thus, it is most likely that a human-developed virus based on
WIV1 is the real origin of this SARS-2 global epidemic event. (note: It is said
that WIV1 refers to: Wuhan Institute of Virology, the 1st).
Material:
Corona virus/related genetic info/data in this essay come from NIH GenBank, such
as:
| Table 1: Samples (source: NIH, GenBank, 2020-04-24) | |||||
| Temp-Name | GenBank ID | Length | Collect Date | Source | |
| 1 | SARS-2 | MN996527.1 | 29825 | y2019-12 | WH-Inst, China |
| 2 | Bat-2012 (WIV1) | KF367457.1 | 30309 | y2012-09 | WH-Inst, China |
| 3 | RaTG13 | MN996532.1 | 29855 | y2013-07 | WH-Inst, China |
| 4 | SARS-2003 | AY304488.1 | 29731 | y2003-05 | HK-Univ, China |
| 5 | Bat-2005 | DQ022305.2 | 29728 | y2005-04 | HK-Univ, China |
| 6 | HuB-2013 | KJ473814.1 | 29658 | y2013-xx | BJ-Inst, China |
| 7 | Bat-Yunnan | JX993988.1 | 29452 | y2011-xx | BJ-Inst, China |
| 8 | SARS-2-USA | MT159718.1 | 29882 | y2020-02 | USA |
| 9 | Bat-2012 (WIV1-S-gene_cds) | KC881007.1 | 3771 | y2012-09 | WH-Inst, China |
| SARS-2 and SARS-2-USA: from Covid-19 patients; the rest: SARS or SARS-like. | |||||
| WH-Inst: Wuhan Institute of Virology. HK-Univ: Hong Kong University. | |||||
| BJ-Inst: Chinese Academy of Medical Sciences & Peking Union Medical College | |||||
Among them, 7 come from Chinese researchers (Wuhan, Hong Kong and Beijing
institutes) and 1 from American collectors. SARS-2 and SARS-2-USA were collected
from local patients, one is earliest possible and the later is most recent by
the date of this writing. Others are SARS/SARS-like viruses.
Bat-2012 (WIV1) is a key factor here, reason:
First, it is known due in large to ACE2 related paper by Dr. Shi
Zhengli (Chinese) and Dr. Daszak (American) in Wuhan Institute of Virology,
please see:
Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2
receptor.
Daszak P, Shi ZL., Nature. 2013 Nov 28;503 (7477):535-8.
https://www.nature.com/articles/nature12711
Secondly, PNAS publication warned that WIV1 is poised and can
directly transmit to human, please see:
SARS-like WIV1-CoV poised for human emergence.
Vineet D. Menachery, .... and Ralph S. Baric. PNAS March 15, 2016.
https://www.pnas.org/content/pnas/113/11/3048.full.pdf
It said:
……. Both full-length and chimeric WIV1-CoV readily replicated efficiently in
human airway cultures and in vivo, suggesting
capability of direct transmission to humans. In addition, while
monoclonal antibody treatments prove effective, the SARS-based vaccine approach
failed to confer protection. Together, the study indicates an ongoing threat
posed by WIV1-related viruses and the need for continued study and surveillance.
…… Synthetic construction of chimeric mutant and
full-length WIV1-CoV were approved by the UNC Institutional Biosafety Committee
and the Dual Use Research of Concern Committee.
As we know, synthetic construction means artificial or manmade work, not a
natural process and, because of it can directly transmit to humans, WIV1 had a
serious potential causing pandemic. Please see below, a warning news report.
Thirdly, at the time when WIV1 was known, relevant media published
warning news report, such as:
New SARS-like virus is poised to infect humans.
Date: March 14, 2016.
https://www.sciencedaily.com/releases/2016/03/160314211501.htm
……Baric and Menachery worked with SARS-like coronavirus sequences isolated from
Chinese horseshoe bats, where SARS originated. Based on the sequences, they
reconstructed the viruses to evaluate their potential to infect human cells and
in mice. They found that the newly identified virus, known as WIV1-CoV,
could bind to the same receptors as SARS-CoV. They also showed that the virus
readily and efficiently replicated in cultured human airway tissues, suggesting
an ability to jump directly to humans.
"To be clear, this virus may never jump to humans, but if it does,
WIV1-CoV has the potential to seed a new outbreak with
significant consequences for both public health and the global economy,"
said Vineet, whose work is reported in the Mar. 13, 2016 online version of the
Proceedings of the National Academy of Sciences.
And the warnings re WIV1 are now becoming a huge reality locally and globally.
Method and Results
The method is provided by NIH-BLAST. The alignment results are:
| Table 2: Alignments | ||||
| Name | Identities | |||
| Query | Subject | S-Gene | Whole | S-Gene x Whole |
| Bat-RaTG13 | SARS-2 | 98% | 96% | 10% |
| Bat-2012(WIV1) | SARS-2 | 63% | 78% | 11% |
| Bat-2012(WIV1) | Bat-RaTG13 | 63% | 78% | 11% |
| Bat-2012(WIV1) | Bat-Yunnan | 89% | ||
| Bat-2012(WIV1) | HuB-2013 | 87% | ||
| Bat-2012(WIV1) | SARS-2003 | 94% | 11% | |
| Bat-RaTG13 | HuB-2013 | 79% | ||
| Bat-2012(WIV1) | SARS-2-USA | 87% | 78% | 11% |
| Bat-2012(WIV1) | Bat-2012 (WIV1-S-cds) | 70% | ||
Discussion
The bat-RaTG13 is said as the origin of SARS-2, for its very high identities.
However, its virus does not directly transmit to human.
WIV1 (Bat-2012) has a lower identities with SARS-2, however, its affinity ratio
is obviously higher than that of bat-RaTG13, shown by 11% and 10%, respectively,
in the above table. More over, its virus can directly transmit to human. And
please note that WIV1 has 94% identity (almost there at 96% of bat-RaTG13) with
SARS-2003 that had caused the 2003 global pandemic.
Based on these terms to estimate, the SARS-2-S-gene with lower identity
(78%-80%) has the affinity power 10 times greater than that of RaTG13 which has
a much higher identity up to 96%.
To further study WIV1, aligning it with others provided by the above samples,
then, there come uniformed gaps, such as:
>GAP-1,by Bat-RaTG13 x Bat-2012:
TCCTTGATAAACGAACCACTATGTTACTTTTAGTAACATTGTTTGGTTTAGCATCAGGGT
GCAGCTTACCACTTACGGTTAGCTGCCCTAGAGGCCTACCTTTCACTCTACAGATTAACA
CTACTAGTGTTACTGTGGAGTGGTATCGGGTATCTCCTGCATCAATGCAAGGTCTTACAA
AGATAAATACTGGCAGCACTATTTTTGATAACAACTTTAGTGTAGTCAATAATAATTTGT
ACTTCAAACAGTGTTTTGGAGGCTTTTTTTTACAGCACGCTGTTACCGCCAGGGTAAGCA
TGACGGTGCTATAGTAGATAATTCTCAACCTGTCTTTGTGGATGCTAGGAATTATGTACC
AACTACTGCACTATTAGTCTCATCGCAGGGCATTGTGCAGCCAAAAAGTTCCAATGTGTT
AGCTATAGTGTTACCTATAGCCCTTGTTGGTATTTGTCTTTTTATTCTTTTACTTTGGTA
TTTGTTTTCTAAGCAAAACAAAATTTACCAACAGGCCACGCAATCAGTCTAA
>Gaps, the Rest Alignments
CGAACCACTATGTTACTTTTAGTAACATTGTTTGGTTTAGCATCAGGGTGCAGCTTACCA
CTTACGGTTAGCTGCCCTAGAGGCCTACCTTTCACTCTACAGATTAACACTACTAGTGTT
ACTGTGGAGTGGTATCGGGTATCTCCTGCATCAATGCAAGGTCTTACAAAGATAAATACT
GGCAGCACTATTTTTGATAACAACTTTAGTGTAGTCAATAATAATTTGTACTTCAAACAG
TGTTTTGGAGGCTTTTTTTTACAGCACGCTGTTACCGCCAGGGTAAGCATGACGGTGCTA
TAGTAGATAATTCTCAACCTGTCTTTGTGGATGCTAGGAATTATGTACCAACTACTGCAC
TATTAGTCTCATCGCAGGGCATTGTGCAGCCAAAAAGTTCCAATGTGTTAGCTATAGTGT
TACCTATAGCCCTTGTTGGTATTTGTCTTTTTATTCTTTTACTTTGGTATTTGTTTTCTA
AGCAAAACAAAATTTACCAACAGGCCACGCAATCAGTCTAA
A natural process is random. Such a uniformed gap at the same location with the
same length, or uniformed mutation, would be impossible
within natural animals in a
period of less than 20 years. However, manmade work, such as gene editing or
other genetic modification, can make it happen in just a year or few months.
That means that natural animals such as bats do not have those uniformed gap
genes. Then the question is: where does the gap gene come from?
By NIH BLAST covid-19 search, the result is:
| Table 3: GAP Search | |||
| Organism | Per. Ident | Discroibtion | Source |
| KF367457.1 | 100.00% | Bat SARS-like WIV1 | WH-Inst,2012-09 |
| KT444582.1 | 99.62% | SARS-like WIV16 | WH-Inst,2013-07 |
| KY417150.1 | 99.25% | Bat SARS-like Rs4874 | WH-Inst,2013-07 |
| MK211378.1 | 98.87% | BtRs-BetaCoV/YN2018D | BJ-Inst,2016-09 |
| MK211376.1 | 98.87% | BtRs-BetaCoV/YN2018B | BJ-Inst,2016-09 |
| KY417151.1 | 98.68% | Bat SARS-like Rs7327 | WH-Inst,2014-10 |
The result shows that the gap genes come from Wuhan or Beijing institutes,
China. If the SARS-2 origin is natural animals such bats, why not do they come
but just those SARS-like come from Wuhan and Beijing institutes?
Further, take WIV1-S-Gene (3768 bp) as root, the search result is (criteria: NIH,
Data-base-genomic / Viruses / Betacoronavirus):
| Table 4: WiV1 S-Gene Search (by NIH Blast) | |||
| Accession | Per. Ident | Discribtion | Year |
| GM741413.1 | 91.74% | Sequence 147 from Patent WO2008004992 | 2008 |
| HC187344.1 | 91.74% | Sequence 1313 from Patent WO2009130588 | 2009 |
| HC494680.1 | 91.74% | Sequence 1313 from Patent WO2009022236 | 2009 |
| LQ338105.1 | 91.74% | Sequence 147 from Patent EP3001990 | 2016 [*] |
| CS244439.1 | 78.48% | Sequence 3 from Patent WO2005118813 | 2006 |
| CS244442.1 | 78.48% | Sequence 6 from Patent WO2005118813 | 2006 |
| [*]: Updated from 2005 version. | |||
All are not bat or other animals, but patents filed before WIV1 was collected.
As we know, natural things cannot be patented, i.e., patents re S-Gene
recombination are manmade.
A Piece of Cake
In 2007, the Wuhan Institute of Virology had an S-Gene patent of SARS corona
virus, see:
Recombination baculoviral for highly effectively expressing SARS coronavirus S
protein and construction thereof.
CN101100680, 15.06.2007, by Wuhan Institute of Virology, CAS.
https://patentscope.wipo.int/search/zh/detail.jsf?docId=CN83294681
It produced manmade S-gene. Let’s call it as Patent-2007 and align it with some
of the above samples, result:
| Table 5: Patent-2007 (3768 bp) as Query, Alignment: | |||
| Subject | Length | Date | Identities |
| S-Gene from WIV1 | 3768 | y2012-09-18 | 68% |
| S-Gene from WIV16 | 3765 | y2013-07-21 | 69% |
| S-Gene from RaTG13 | 3807 | y2013-07-24 | 63% |
| S-Gene from SARS-2 | 3819 | y2019-12-30 | 63% |
| WIV1 S-Gene (cds) | 3771 | y2012-09-18 | 90% |
The identities are highly similar to each other. Since they are in different
length and came years after the patent 2007, the similarity well raises a point
that the new corona virus contains manmade factors such as gene editing.
And that includes bat RaTG13 genome, which was collected in 2013-07 but shared
with international community in January 2020. Since CRSIPR/Cas has become
popular in China and gene-edited babies were born there, anything can happen in
the nation: It would be just a piece of cake that the new corona virus and its
container like bat RaTG13 are genetically modified.
The identity of [patent-2007 x WIV1-S-Gene-cds] is 90%, obviously higher than
others. And the identity of [WIV1-S-Gene_cds x S-Gene-WIV1-2012] is 70% (see
above, Table-2), although both come from the same source, host, location and
date, and the same paper.
How come? The providers (the Chinese and American researchers of The Wuhan
Institute of Virology) did not explain, leaving some serious missing genetic
information links among the patents, WIV1 and its S-Protein-Gene, SARS-2 and
this global corona-virus pandemic.
Therefore, one should not be surprised that, on 2018-04-05, the PRC state-run
media announced that Wuhan Institute found the new corona-virus and, on
2019-09-18, just two month before the SARS-2 outbreak started, a real-time
exercise, which applied the new corona-virus and its pandemic as a sample case,
was held in Wuhan City, China.
So far, some key genetic info/data of the announced / exercised new corona virus
remains closed to the international community, while the virus is spreading all
over the world and caused tens of thousands casualties.
.
Reference Images (top down)
Image 01: A Uniformed GAP, Search Result.
(identical organisms
pointing at Wuhan and Beijing, China, dated from 2012 to 2016).
Figure 1: WIV1 S-Gene (3768) as root, align search result is (criteria:
NIH, Data-base-genomic / Viruses / Betacoronavirus): All are patents which had
been filed years before WIV1 was collected.
Figure 2: In March 2016, NAS publication warned WIV1, a corona virus,
could directly transmit to human and cause serious pandemic around the world.
The photo image, in which people were wearing masks in subway, is now becoming a
daily must around the globe.
Figure 3: April 5, 2018, the CCTV (PRC state run media) announced that
Wuhan Institute of virology found a SARS-like new corona virus and took it as an
important achievement by the Chinese scientists.

Figure 4: September 18, 2019, in Wuhan City of China, a local government
new media reported that a real-time exercise was held, which used the new corona
virus and its epidemic/treatment as a sample case.


Comments
Post a Comment