SARS-2 Origin: WIV1 pk RaTG13
Zhiyan-Le, 2021-03-30.
https://zhiyanleback.blogspot.com/p/sars-2-origin-wiv1-pk-ratg13-zhiyan-le.html

The WHO China mission report on SARS-2 origin stated: SARS-CoV-2 also shares a 96.2% homology with a sequence of a strain of coronavirus (RaTG13) previously identified by genetic sequencing from a horseshoe bat sample (Rhinolophus species) and to a lesser extent with a strain isolated from pangolins. The RaTG13 virus sequence is the closest known sequence to SARS-CoV-2. #

That is done by single gene alignment. However, when the virus and ACE2 are running, they work by Codon-protein, that is, three base genes as one unit. Clearly, some Codon studies may have to be in place, which may lead to different solutions.

For example, we have two gene strings:

TTTCCAGGTAACAAACCAACG
CTTTCCAGGTAACAAACCAAC

Using single gene alignment method, they have 91% identity:
 

Identities: 20/22(91%)
Gaps: 1/22(4%)
Query  1    TTTCCAGGTAACAAACCAACG	21
||||||||||||||||||||
Sbjct  1   CTTTCCAGGTAACAAACCAAC	21

And applying a study on the Codon level which is a reality in running, they have a 0% similarity: 
 

TTT	CCA	GGT	AAC	AAA	CCA	ACG
CTT	TCC	AGG	TAA	CAA	ACC	AAC

WIV1 pk RaTG13

Now there are two possible origins re SARS-2: RaTG13, mentioned above, which cannot directly jump to humans; another is WIV1 (GenBank: KF367457), a lab-constructed nCov, which was warned by NAS (US National Academy of Science) in March 2016 that it can directly jump to humans and cause huge pandemic and economic losses.

Take NC_045512 as basic sample (collected from Wuhan patient, short name WH-01), and do some alignment studies on the Codon level, the similarities are like this:
 

SARS-2: Codon Frequence, Distribution and Distance (original data: NIH GenBank, by 2021-02-22)
	WH-01			WIV1			RaTG13			WIV1 from WH-01			RaTG13 from WH-01
	1st	2nd	3rd	1st	2nd	3rd	1st	2nd	3rd	1st	2nd	3rd	1st	2nd	3rd
A	3075	2903	3137	3061	2855	2738	2828	3087	3011	-14	-48	-399	-247	184	-126
C	2132	1610	1862	2051	2135	1876	1599	1838	2073	-81	525	14	-533	228	211
G	1525	1909	2517	2389	1629	2276	1921	2466	1459	864	-280	-241	396	557	-1058
T	3425	3735	2641	2602	3484	3213	3603	2560	3408	-823	-251	572	178	-1175	767
avrg	2539.25			2525.75			2487.75			-13.5			-51.5
align w WH-01:				0.99468			0.97972

The ACGT are base genes; 1st-2nd-3rd refers to first, second and third base gene. The distance is calculated in a very simple but strait forward way: WIV1 (or RaTG13) value minus WH-01.

Result 1: WIV1 has a 0.99468 similarity to basic sample (WH-01, Wuhan patient sample), much higher than that of RaTG13 (0.97972).
Result 2: From WH-01, WIV1 has a distance (-13.5), much shorter than that of RaTG13 (-51.5).

Other factors:
Sept.18 2019, in Wuhan metro area, the PRC authorities hosted a real-time exercise re pandemic emergencies, for which Wuhan Institute of Virology provided SARS-2 samples and relevant testing/treatment tech-skills. And the RaTG13 provider, Wuhan Institute of Virology, stated that they do not have RaTG13 live-samples but genomic sequences; Meanwhile, WIV1 is their lab-constructed SARS-2, meaning that the institute can provide it at any time anywhere.
Plus, as said above, WIV1 can but RaTG13 cannot directly jump to humans.

Based on the above, lab-made WIV1 is the most possible origin re SARS-2, not RaTG13 or other bats. (note: The PRC authorities have closed the area where RaTG13 was collected. WHO report did not clearly say if they demanded to go there and repeat the collection, a common method to test if a sample can be held true.)

PS:
The WHO report used some fake data made by PRC institutes. See:
https://zhiyanleback.blogspot.com/2021/03/who-sars-2-origin-report-uses-fake-data.html
https://zhiyanleback.blogspot.com/p/who-report-uses-fake-data-grand-failure.html  (in Chinese language).
=-==========